This document serves as a guide for understanding the HML document structure, as an alternative to having to read through the DTD itself. For each element of the DTD, a description is given for that element, its attributes, and its child elements.
Description:
hml is the root element of the document. Any document-level properties may be
defined with property elements.
| Name | Type | Required? | Description |
|---|---|---|---|
| version | CDATA | Yes | The version of HML that this document should conform to. |
Children:
| property | 0 or more |
| project | 1 or more |
Description:
The project element groups data into sections with a common destination
or purpose, which is denoted by the "name" attribute.
| Name | Type | Required? | Description |
|---|---|---|---|
| name | CDATA | Yes | Identifier for data's intent. (ex: "STAR", "SG09") |
Children: (in order)
| reporting-center | 1 |
| sample | 1 or more |
| typing-test-names | 0 or more |
Description:
The reporting-center element specifies the origin of the data as a
center code.
| Name | Type | Required? | Description |
|---|---|---|---|
| code | CDATA | Yes | Reporting center code identifier |
Children: none
Description:
A "sample" element encloses the typing data pertaining to a particular
sample. It may contain multiple typing elements. One for each locus,
for instance. Any sample-level properties may be defined with
property elements.
| Name | Type | Required? | Description |
|---|---|---|---|
| id | CDATA | Yes | Identifier for the sample |
| center-code | CDATA | Yes | Center code of the sample's origin (donor center, transplant center, etc. |
Children:
| property | 0 or more |
| typing | 1 or more |
Description:
The typing element encapsulates a typing call combined with other
primary data that may have been used to determine that call (sso, ssp,
and/or sbt elements).
Contains:
| Name | Type | Required? | Description |
|---|
Children:
| interpretation | 0 or 1 (must appear first) |
| sso | 0 or more |
| ssp | 0 or more |
| sbt | 0 or more |
Description:
interpretation element specifies the typing call at allele/code level.
Usually contains one or two haploid elements for a particular locus, but
may contain more if multiple loci are covered (example: two DRB1
haploids + one DRB3 haploid). As an alternative, it may contain genotype
list(s) to represent the type(s).
| Name | Type | Required? | Description |
|---|---|---|---|
| date | CDATA | Yes | Date on which the typing was carried out, or on which the final call was determined. Format can be either ISO-8601 or "YYYYMMDD". |
Children:
| haploid | 1 or more, or |
| genotype-list | 1 or more |
Description:
A haploid element specifies one-half of a full typing at a particular
locus.
| Name | Type | Required? | Description |
|---|---|---|---|
| locus | CDATA | Yes | Locus (ex: "A", "DRB1") |
| method | CDATA | Yes | Typing method used (ex: "DNA", "SEROLOGY") |
| type | CDATA | Yes | Allele/code level type (ex: "0101", "01AB") |
Children: none
Description:
A genotype-list represents a full unambiguous list of possibilities for the
typing of a sample. The values of the elements in this genotype-list (each
allele element) should conform to the naming nomenclature used by the the
source specified by the db attribute (if provided) or should be fully
understood by the message recipient (if not provided).
| Name | Type | Required? | Description |
|---|---|---|---|
| db | CDATA | No | Database or other source from which elements in this genotype-list are taken (ex: "HLADB") |
| version | CDATA | No | A specific version of the aforementioned source (ex: "2.8.0") |
Children:
| diploid-combination | 1 or more |
Description:
A diploid-combination element is one possibility value in a genotype list.
There may be either one or two locus-block child elements, depending on whether
the data provided in this diploid-combination covers one or two chromosomes.
| Name | Type | Required? | Description |
|---|
Children:
| locus-block | 1 or 2 |
Description:
A locus-block element allows allele-list elements to be grouped together to
mean one allele-list is a possibility if and only if all others are. This is
useful, for example, in the case when listing DRB1 alleles next to the
corresponding DRB3 alleles that are relevent in only some cases:
<locus-block>
<allele-list>
<allele>DRB1*030101</allele>
<allele>DRB1*0303</allele>
</allele-list>
<allele-list>
<allele>DRB3*0203</allele>
</allele-list>
</locus-block>
Attributes:
| Name | Type | Required? | Description |
|---|
Children:
| allele-list | 1 or more |
Description:
An allele list element is a representation of the list of allele
possibilities for a type. NMDP has historically used allele codes in
combination with allele families to represent this.
Example: A*01BC can now be represented as:
<allele-list>
<allele>A*0102</allele>
<allele>A*0103</allele>
</allele-list>
Attributes:
| Name | Type | Required? | Description |
|---|
Children:
| allele | 1 or more |
Description:
An allele element specifies a single allele. It should be given in
LOCUS*NAME format and names must be at allele-level resolution. The value
should conform to the naming nomenclature used by the the source specified
in the enclosing genotype-list element (if it was provided) or should be
fully understood by the message recipient (if it was not).
Example:
<allele>A*010101</allele>
Attributes:
| Name | Type | Required? | Description |
|---|---|---|---|
| present | 'Y'|'N'|'U' |
No | Indicates presence of absence of this allele. A value of "N" can be used to indicate that a particualar allele was tested for and found not to be a possibility. A value of "U" (untested) indicates that the given allele was not tested for. The default value is "Y" |
Children: none
Description:
Specifies an SSO test that was done. Scores are required, along
with a reference for resolving what SSO probes correspond to the list of
scores. Only one of "ref-id", "probe-name", or "nmdp-refid" may be given.
| Name | Type | Required? | Description |
|---|---|---|---|
| ref-id | IDREF | No | Internal XML reference to a typing-test-names element contained in this document. |
| nmdp-refid | CDATA | No | ID of kit registered with NMDP. The cardinal sequence numbers of the registered probes in the kit will determine the score order. |
| probe-name | CDATA | No | Fully qualified probe name. (ex: "L999.K1.V1.A9F-S11") If this attribute is used, the scores attribute must contain exactly one score. |
| scores | CDATA | Yes | The results of the SSO test, specified as one string (ex: "118111100181") |
Children: none
Description:
Specifies an SSP test that was done. Scores are required, along
with a reference for resolving what SSPs correspond to the list of
scores. Only one of "ref-id", "name", or "nmdp-refid" may be given.
| Name | Type | Required? | Description |
|---|---|---|---|
| ref-id | IDREF | No | Internal XML reference to a typing-test-names element contained in this document. |
| nmdp-refid | CDATA | No | ID of kit registered with NMDP. The cardinal sequence numbers of the registered SSPs in the kit will determine the score order. |
| name | CDATA | No | Fully qualified SSP name. (ex: "L999.K1.V1.SSP12345") If this attribute is used, the scores attribute must contain exactly one score. |
| scores | CDATA | Yes | The results of the SSP test, specified as one string (ex: "118111100181") |
Children: none
Description:
Specifies an SBT test that was done. The result of the test (the DNA
sequence) is given in the child "sequence" element.
| Name | Type | Required? | Description |
|---|---|---|---|
| name | CDATA | Yes | Fully qualified name of the SBT test (ex: "L999.K1.V1.SBT54321") |
| score | CDATA | Yes | Result of primer amplification used for this test. This is usually '8', but may be '1' in which case no amplification happened and no sequence is likely to have been obtained. |
Children:
| sequence | 1 |
Description:
The sequence element contains the DNA sequence obtained from an SBT
test. Primary (A, C, G, T) and wildcard nucleotides
(M, R, W, S, Y, K, V, H, D, B, X, N) may be used (ex:
"<sequence>CCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCAC</sequence>")
| Name | Type | Required? | Description |
|---|
Children:
| PCDATA |
Description:
The typing-test-names element specifies a list of test names internally
referenced by an sso element or an ssp element. It wraps a list of
"typing-test-name" elements.
| Name | Type | Required? | Description |
|---|---|---|---|
| ref-id | ID | Yes | XML ID reference unique in this document. |
Children:
| typing-test-name | 1 or more |
Description:
A typing-test-name element specifies a test name contained in a
referenced "typing-test-names" list.
| Name | Type | Required? | Description |
|---|---|---|---|
| name | CDATA | Yes | Fully qualified test name (ex: "L999.K1.V1.A9F-S11", "L999.K1.V1.SSP12345") |
Children: none
Description:
A property is a generic name-value pair
| Name | Type | Required? | Description |
|---|---|---|---|
| name | CDATA | Yes | Name of this property |
| value | CDATA | Yes | Value of this property |
Children: none